View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0727_low_34 (Length: 297)
Name: NF0727_low_34
Description: NF0727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0727_low_34 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 147; Significance: 2e-77; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 74 - 242
Target Start/End: Complemental strand, 6330462 - 6330297
Alignment:
| Q |
74 |
aactctgtcaaagaagatggaaaaaagcaagaagaaacgaagaaaggatcatagttcaacaagaaacgatgatgatggtagtgacattattgaaccagaa |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6330462 |
aactctgtcaaagaagatggaaaaaagcaagaagaaacgaagaaaggatcatagttcaacaagaaacgatgatgatggtagtgacattattgaaccagaa |
6330363 |
T |
|
| Q |
174 |
aacatgccaatatcgttttcaaacaaagactatgcattattcaaaggaactagtgctcctcttcctatg |
242 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
6330362 |
aacatgccaatatcgttttcaaccaaagactatgc---attcaaaggaactagtgctcttcttcctatg |
6330297 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3963 times since January 2019
Visitors: 4825