View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0727_low_36 (Length: 291)
Name: NF0727_low_36
Description: NF0727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0727_low_36 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 30 - 253
Target Start/End: Original strand, 46872226 - 46872449
Alignment:
| Q |
30 |
tattccttaccaaaaatacacacataagtgttgtgtgaacttctcctacataaacactagattttctcgagaaagatattttgcactagcgttgaaattt |
129 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46872226 |
tattccttaccaaaaatacacacatcagtgttgtgtgaacttctcttacataaacactagattttctcgagaaagatattttgcactagcgttgaaattt |
46872325 |
T |
 |
| Q |
130 |
tggtctatttttaattacagaatctcgagactcttgttacaacgttgtacaaacacatacactacaccaatttatgtttttaccttaaaacaacaaaatg |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46872326 |
tggtctatttttaattacagaatctcgagactcttgttacaacgttgtacaaacacaaacactacaccaatttatgtttttaccttaaaacaacaaaatg |
46872425 |
T |
 |
| Q |
230 |
cacgtttagtttaaattacactcc |
253 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
46872426 |
cacgtttagtttaaattacactcc |
46872449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University