View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0727_low_40 (Length: 263)
Name: NF0727_low_40
Description: NF0727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0727_low_40 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 201; Significance: 1e-110; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 30 - 242
Target Start/End: Original strand, 19377288 - 19377500
Alignment:
| Q |
30 |
agaaataacacggttgatttgttaccggagtacaaggcatgggcttcgtttggtagcttcgccactgcttgaaagcaatatatctagtttataacattca |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
19377288 |
agaaataacacggttgatttgttaccggagtacaaggcatgggcttcgtttggtagcttcgccactgcgtgatagcaatatatctagtttataacattca |
19377387 |
T |
 |
| Q |
130 |
gaattctttctgaatttctttagaaatgtgtagctaaatactttttggttctctttctgaattctttctactaacacacagcagcagccaccgttatctt |
229 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19377388 |
gaattctttctgaatttctttagaaacgtgtagctaaatactttttggttctctttctgaattctttctactaacacacagcagcagccaccgttatctt |
19377487 |
T |
 |
| Q |
230 |
tcctcccctcccc |
242 |
Q |
| |
|
||||||||||||| |
|
|
| T |
19377488 |
tcctcccctcccc |
19377500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 42 - 80
Target Start/End: Complemental strand, 29564548 - 29564510
Alignment:
| Q |
42 |
gttgatttgttaccggagtacaaggcatgggcttcgttt |
80 |
Q |
| |
|
|||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
29564548 |
gttgatctgttgccggagtacaaggcatgggcttcgttt |
29564510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 78 - 129
Target Start/End: Complemental strand, 24971085 - 24971034
Alignment:
| Q |
78 |
tttggtagcttcgccactgcttgaaagcaatatatctagtttataacattca |
129 |
Q |
| |
|
|||||||| | ||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
24971085 |
tttggtagttccgccactgcgtgaaagcaatatatctagtttataacattca |
24971034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University