View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0727_low_41 (Length: 257)
Name: NF0727_low_41
Description: NF0727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0727_low_41 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 6593698 - 6593925
Alignment:
| Q |
1 |
tttcaaaattattatcgatgtcagtgtttggtatatcacaaatttatgtatcggtggataagcttaaataagtcaaatacaaacacgcttaatctcatag |
100 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6593698 |
tttcaaaattattatcgatgtcggtgtttggtatatcacaaatttatgtatcggtggataagcttaaataagtcaaaaacaaacacgcttaatctcatag |
6593797 |
T |
|
| Q |
101 |
aaacattgaaatagtgattgatttgcatgagaaccttagctttgggaatgactttaacagcaacttgttgacctttgcgatcacctttcttcaacctcgc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6593798 |
aaacattgaaatagtgattgatttgcatgagaaccttagctttgggaatgactttaacagcaacttgttgacctttgcgatcacctttcttcaacctcgc |
6593897 |
T |
|
| Q |
201 |
agcacaagtatatccaaaatgtcctctt |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
6593898 |
agcacaagtatatccaaaatgtcctctt |
6593925 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3238 times since January 2019
Visitors: 4808