View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0727_low_49 (Length: 215)
Name: NF0727_low_49
Description: NF0727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0727_low_49 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 127; Significance: 9e-66; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 1 - 131
Target Start/End: Original strand, 5599624 - 5599754
Alignment:
| Q |
1 |
ttattttcccttaataattgcagttgcaattgggtatctctctcttctatctaatatttatacttatagggttgcacatgtgcacacgtgcacacgtggg |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5599624 |
ttattttcccttaataattgcaattgcaattgggtatctctctcttctatctaatatttatacttatagggttgcacatgtgcacacgtgcacacgtggg |
5599723 |
T |
 |
| Q |
101 |
tgactatgtcacaactatttaagttgaagga |
131 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
5599724 |
tgactatgtcacaactatttaagttgaagga |
5599754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University