View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0728_high_16 (Length: 258)
Name: NF0728_high_16
Description: NF0728
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0728_high_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 246
Target Start/End: Original strand, 8085981 - 8086224
Alignment:
| Q |
1 |
ataaaagtagtgtaatgcaagnnnnnnncaatcacttatctgaaccccttcgtcatccatcactttgatcaccattgacaacaattccaaccaccactga |
100 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8085981 |
ataaaagtagtgtaatgcaagaaaa---caatcacttatctgaacaccttcgtcatccatcactttgatcaccattgacaacaattccaaccaccactga |
8086077 |
T |
|
| Q |
101 |
tta-tattatgaccaaaactctagccgcctctcacccccacttaatttgatctccattggctaccactcagttggctaccatcaaccaccactgatcgcc |
199 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
8086078 |
ttactattatgaccaaaactctagccgcctctcacccccacttaatttgatctccattggctaccactcagttggctaccaccaaccaccactgatcgcc |
8086177 |
T |
|
| Q |
200 |
actctaacaatcgccggtgattaacaatttagcaaaaccatgagtat |
246 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8086178 |
actctagcaatcgccggtgattaacaatttagcaaaaccatgagtat |
8086224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5301 times since January 2019
Visitors: 4847