View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0728_high_22 (Length: 250)
Name: NF0728_high_22
Description: NF0728
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0728_high_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 150; Significance: 2e-79; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 21 - 188
Target Start/End: Complemental strand, 23349984 - 23349820
Alignment:
Q |
21 |
acatcatcaaaatgttctacatatgtcatttattaaattgaaatatttagtgatagcacatggataaattcttgtgatttgtaatcacgaacacataatc |
120 |
Q |
|
|
||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
23349984 |
acatcatcaaaatgttcaacatatgtc---tattaaattgaaatatttagtgatagcacatggataaattcttgtgatttgtaatcacgaacacataatc |
23349888 |
T |
 |
Q |
121 |
atctccaatggagaaattcttgaaatatttaatgatagctcatggcgaaagttctttgacaagaaaag |
188 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
23349887 |
atctccaatggagaaattcttgaaatatttaatgatagctcatggcgaaagttctttgacaagaaaag |
23349820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 208 - 250
Target Start/End: Complemental strand, 23349801 - 23349759
Alignment:
Q |
208 |
gttaccgcttcggttattcctgggttaggtctcatgtcccccg |
250 |
Q |
|
|
||||| |||||||||||| |||||||||||||||| ||||||| |
|
|
T |
23349801 |
gttactgcttcggttatttctgggttaggtctcatatcccccg |
23349759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 31 - 75
Target Start/End: Complemental strand, 23451367 - 23451323
Alignment:
Q |
31 |
aatgttctacatatgtcatttattaaattgaaatatttagtgata |
75 |
Q |
|
|
||||||| |||| ||||||||||||||||| |||||||| ||||| |
|
|
T |
23451367 |
aatgttcaacatgtgtcatttattaaattggaatatttaatgata |
23451323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University