View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0728_low_28 (Length: 251)

Name: NF0728_low_28
Description: NF0728
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0728_low_28
NF0728_low_28
[»] chr2 (1 HSPs)
chr2 (1-222)||(7380923-7381145)


Alignment Details
Target: chr2 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 7381145 - 7380923
Alignment:
1 ccaagaagcttttttgcatgggaattcccaaaagggtagttgaaagagagacaaagacaagaacttgtaagagaagatggtattgtccttctggtcccat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7381145 ccaagaagcttttttgcatgggaattcccaaaagggtagttgaaagagagacaaagacaagaacttgtaagagaagatggtattgtccttctggtcccat 7381046  T
101 gtgatcagctgaatgaagatggaagagaagaagctgttgaa-aaaagccatagaagctaggaattgtgttagggcaagttttgcttggttttcgattttg 199  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7381045 gtgatcagctgaatgaagatggaagagaagaagctgttgaaaaaaagccatagaagctaggaattgtgttagggcaagttttgcttggttttcgattttg 7380946  T
200 tcaaggattatggaggatgcggc 222  Q
    |||||||||||||||||||||||    
7380945 tcaaggattatggaggatgcggc 7380923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 4382 times since January 2019
Visitors: 4835