View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0728_low_28 (Length: 251)
Name: NF0728_low_28
Description: NF0728
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0728_low_28 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 7381145 - 7380923
Alignment:
Q |
1 |
ccaagaagcttttttgcatgggaattcccaaaagggtagttgaaagagagacaaagacaagaacttgtaagagaagatggtattgtccttctggtcccat |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7381145 |
ccaagaagcttttttgcatgggaattcccaaaagggtagttgaaagagagacaaagacaagaacttgtaagagaagatggtattgtccttctggtcccat |
7381046 |
T |
 |
Q |
101 |
gtgatcagctgaatgaagatggaagagaagaagctgttgaa-aaaagccatagaagctaggaattgtgttagggcaagttttgcttggttttcgattttg |
199 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7381045 |
gtgatcagctgaatgaagatggaagagaagaagctgttgaaaaaaagccatagaagctaggaattgtgttagggcaagttttgcttggttttcgattttg |
7380946 |
T |
 |
Q |
200 |
tcaaggattatggaggatgcggc |
222 |
Q |
|
|
||||||||||||||||||||||| |
|
|
T |
7380945 |
tcaaggattatggaggatgcggc |
7380923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University