View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0728_low_29 (Length: 251)
Name: NF0728_low_29
Description: NF0728
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0728_low_29 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 22 - 238
Target Start/End: Original strand, 32686450 - 32686666
Alignment:
| Q |
22 |
catcatcatctgttgcaaaacccccctgctttatagtgaaaacaaccatattgaaatttatgcaaagtggtatccacctctttctatcttaacattgata |
121 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32686450 |
catcaccatctgttgcaaaaaccccctgctttatagtgaaaacaaccatattgaaatttatgcaaagtggtatccacctctttctatcttaacattgata |
32686549 |
T |
 |
| Q |
122 |
ttggttctcattacagtgtcaatggccttttagcgtgtagaagccttaccaaggattctgagggtcggtttattcgtggcttcgtttgtatccttggtca |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32686550 |
ttggttctcattacagtgtcaatggccttttagcgtttagaagccttaccaaggattctgagggtcggtttattcgtggcttcgtttgtatccttggtca |
32686649 |
T |
 |
| Q |
222 |
atcaacttctatattgg |
238 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
32686650 |
atcaacttctatattgg |
32686666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University