View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0728_low_32 (Length: 250)
Name: NF0728_low_32
Description: NF0728
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0728_low_32 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 29 - 218
Target Start/End: Original strand, 39765201 - 39765390
Alignment:
| Q |
29 |
acaatatgcggtgttttccgccaaagtcaaagattaaagcggttggctttaacacataaggcattttgtgatgtttttgcaaacaaatagttcgttgtat |
128 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39765201 |
acaatctgcggtgttttccgccaaagtcaaagattaaagcgtttggctttaacacataaggcattttgtgatgtttttgcaaacaaatagttcgttgtat |
39765300 |
T |
|
| Q |
129 |
agcaatgctgttttcaatattatgacatgatgaactcatgtgaaaagtgttaacggtacatgtcagcacaaaaattcaattttcaaaatt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39765301 |
agcaatgctgttttcaatattatgacatgatgaactcatgtgaaaagtgttaacggtacatgtcagcacaaaaattcaattttcaaaatt |
39765390 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3100 times since January 2019
Visitors: 4805