View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0728_low_41 (Length: 209)
Name: NF0728_low_41
Description: NF0728
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0728_low_41 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 15 - 187
Target Start/End: Original strand, 9502556 - 9502728
Alignment:
| Q |
15 |
cataggctgtaggaaggaaatggaggatgcggtgagtgtggggataggttttacgatgaaggatggagagaagtgtgatttcttcggtgtttatgatggt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9502556 |
cataggctgtaggaaggaaatggaggatgcggtgagtatggagataggttttacgatgaaggatggagagaagtgtgatttcttcggtgtttatgatggt |
9502655 |
T |
|
| Q |
115 |
cacggtggtgctcaggtggcggtgtcgtgtagagagaggttgtataggattgtggcggaggaggtcgagatgt |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
9502656 |
cacggtggtgctcaggtggcggtgtcgtgtagagagaggttgtataggattgtggcggaggaggttgagatgt |
9502728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3460 times since January 2019
Visitors: 4814