View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0728_low_42 (Length: 202)
Name: NF0728_low_42
Description: NF0728
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0728_low_42 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 5 - 183
Target Start/End: Original strand, 31541688 - 31541866
Alignment:
| Q |
5 |
actgttcccattagcactattgttaacacttaacagagtataccatcaactattataggctgtaaagagagagcaacaatataatgcgatcaaagatcac |
104 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
31541688 |
actgttcccattagcattattgttaacacttaacagagtataccatcaactattataggctgtaaagagagaacaacaatataatgcgatcaaagatcac |
31541787 |
T |
|
| Q |
105 |
ttaatttgattacttttcccatcaaatttttcatgaaaaatctaagagnnnnnnnccatcattcacacgtgatgatgtc |
183 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
31541788 |
ttaatttgattgcttttcccatcaaatttttcatgaaaaatctaagagagaaaaaccatcattcacacgtgttgatgtc |
31541866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4635 times since January 2019
Visitors: 4838