View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0728_low_8 (Length: 376)
Name: NF0728_low_8
Description: NF0728
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0728_low_8 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 102 - 376
Target Start/End: Complemental strand, 6315347 - 6315073
Alignment:
| Q |
102 |
ccatctgcccaacaagtctccgttgctactaatccacctgttgccatatgacaagtacccctgttgtggttttttccatctactatatgcctcgtgttaa |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
6315347 |
ccatctgcccaacaagtctccgttgctactaatccacctgttgccatatgacaagtacccctgttgtggtcttttccatctactatatgcctcgtgttaa |
6315248 |
T |
|
| Q |
202 |
tctccaaattctaagtattttgctgctttttcttttgccatttcaaaacaacagggaactaaatagcttgttggattgttgccaggcatattccaaagct |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6315247 |
tctccaaattctaagtattttgctgctttttcttttgccatttcaaaacaacagggaactaaatagcttgttggattgttgccaggcatattccaaagct |
6315148 |
T |
|
| Q |
302 |
gcttacttcttctcttccatatattccacaacaccatagttaaaccattcataatcattgttgtgcagttgttga |
376 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6315147 |
gcttacttcttctcttccatatattccacaacaccatagttaaaccattcataatcattgttgtgcagttgttga |
6315073 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2675 times since January 2019
Visitors: 4796