View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0729_high_8 (Length: 215)
Name: NF0729_high_8
Description: NF0729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0729_high_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 139; Significance: 6e-73; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 139; E-Value: 6e-73
Query Start/End: Original strand, 1 - 147
Target Start/End: Original strand, 4985486 - 4985632
Alignment:
Q |
1 |
ttgaagaaatagcacaaatagatggtagatttaaggttatgaagcaaaatgggattgttagattggagggaattgagacaaggatagatgaacaactcag |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
T |
4985486 |
ttgaagaaatagcacaaatagatggtagatttaaggttatgaagcaaaatgggattgttagattggagggaattgagacaaggatagttgaacaactcag |
4985585 |
T |
 |
Q |
101 |
tatagatatagaaatttttgaagttacattttcattttatattgttg |
147 |
Q |
|
|
||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
4985586 |
tatagatatagaaatttttgaagttacatcttcattttatattgttg |
4985632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 1 - 147
Target Start/End: Original strand, 4983097 - 4983243
Alignment:
Q |
1 |
ttgaagaaatagcacaaatagatggtagatttaaggttatgaagcaaaatgggattgttagattggagggaattgagacaaggatagatgaacaactcag |
100 |
Q |
|
|
||||||| | ||||||| ||| ||||||||||||||| |||||||||||||||||||||||| |||||||| |||||||| | || ||||||||||| |
|
|
T |
4983097 |
ttgaagagacagcacaattagttggtagatttaaggtgatgaagcaaaatgggattgttagagtggagggatttgagacaggagtaagtgaacaactcac |
4983196 |
T |
 |
Q |
101 |
tatagatatagaaatttttgaagttacattttcattttatattgttg |
147 |
Q |
|
|
|| |||| |||||||||||||||| ||| ||||||||||||||||| |
|
|
T |
4983197 |
cattgatacagaaatttttgaagttgcatcttcattttatattgttg |
4983243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University