View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0729_low_17 (Length: 251)
Name: NF0729_low_17
Description: NF0729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0729_low_17 |
 |  |
|
[»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 155; Significance: 2e-82; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 57 - 251
Target Start/End: Complemental strand, 38662038 - 38661844
Alignment:
Q |
57 |
cacatctagatcgtttgatcaagataaaatattccagatttcaacgcagattctttgaaatctaaaatattgagcttgactgcatgcggccacgggattg |
156 |
Q |
|
|
||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
T |
38662038 |
cacatctagatcgtttgatcaagatcaaatattccagatttcaacgcatattctttgaaatctaaaatattgagcttgactgcatgcggccacggggttg |
38661939 |
T |
 |
Q |
157 |
tgaccgcactcaactcgtatccatactattaaatgtaacttttcatgaagnnnnnnnnggagagaataatttacctaatgccatgacctggtcca |
251 |
Q |
|
|
|||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
T |
38661938 |
tgaccgcactcaactcatatccatactattaaatgtaacttttcatgaagaaaaaaaaggagagaataatttacctaatgccatgacctggtcca |
38661844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 13 - 53
Target Start/End: Complemental strand, 38662103 - 38662063
Alignment:
Q |
13 |
aatatataaagtataaagctcattaattgaaaatttggatt |
53 |
Q |
|
|
|||||||||||||||||||| |||||||||||||||||||| |
|
|
T |
38662103 |
aatatataaagtataaagcttattaattgaaaatttggatt |
38662063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3839 times since January 2019
Visitors: 4822