View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0729_low_19 (Length: 212)
Name: NF0729_low_19
Description: NF0729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0729_low_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 204
Target Start/End: Original strand, 28267578 - 28267781
Alignment:
Q |
1 |
tcctcaatccaaagagacacaataaacatttatttttcctgtcagactgacacacacactgactgatttgttgacactatgaggtggctaaagttcattt |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28267578 |
tcctcaatccaaagagacacaataaacatttatttttcctgtcagactgacacacacactgactgatttgttgacactatgaggtggctaaagttcattt |
28267677 |
T |
 |
Q |
101 |
ttcaatgaatagaaatttgatgcagtgtcgcgatgtggtatagaaagcggtggtttgagttttttcagtgacatagcacttctactaattgatgatgtcc |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
28267678 |
ttcaatgaatagaaatttgatgcagtgtcgcgatatggtatagaaagcggtggtttgagttttttcagtgacatagcacttctactaattgatgaagtcc |
28267777 |
T |
 |
Q |
201 |
atct |
204 |
Q |
|
|
|||| |
|
|
T |
28267778 |
atct |
28267781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University