View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0729_low_6 (Length: 390)
Name: NF0729_low_6
Description: NF0729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0729_low_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 96 - 325
Target Start/End: Original strand, 36734175 - 36734404
Alignment:
Q |
96 |
tgtacatcttacggggaagtttaatatttctgattttatttggttttttaagaactgggatgtccaggggtttagcaaagggttaaaggaaattagggac |
195 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
36734175 |
tgtacatcttacggggaagtttaatatttctgattttatttggttttttaagaactgggatgtccaggggtttagcaaagggttagaggaaattagggac |
36734274 |
T |
 |
Q |
196 |
aggtttgattctatgatggagaggattatcaaggagcatcaagaagtaaggaggaggagaaaggaagttggtggaggagaaggtcaaattaaggatctac |
295 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
T |
36734275 |
aggtttgattctatgatggagaggattatcaaggagcatcaagaagtaaggaggaggagaaaagaagttggtggaggagaaggtcaaattaaggatctac |
36734374 |
T |
 |
Q |
296 |
ttgatattttattggatattcttggagatg |
325 |
Q |
|
|
|||||||||||||||||||||||| ||||| |
|
|
T |
36734375 |
ttgatattttattggatattcttgaagatg |
36734404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University