View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0730_high_16 (Length: 292)
Name: NF0730_high_16
Description: NF0730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0730_high_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 13 - 263
Target Start/End: Complemental strand, 42643387 - 42643137
Alignment:
| Q |
13 |
aatatcataccacacacacgaaggacagactcacaagtaataaagagacgacacataaactcttgcattaaacgacnnnnnnncaccttatttctcgaaa |
112 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
42643387 |
aatatcataccacacacacaaaggacagactcacaagtaataaagagacgacacataaactcttgcattaaacgacaaaaaaacaccttatttctcgaaa |
42643288 |
T |
 |
| Q |
113 |
atcaccatgtgatgcaggaggtttgcccgaacatgtgctctatctaaatgcaattgccatgaaaaaacaatgactttagaaggtgatgtactcgtccaaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
42643287 |
atcaccatgtgatgcaggaggtttgcccgaacatgtgctctatctaaatgcaattgccatgaaaaaacaatgactttagaaggtgatggactcgtccaaa |
42643188 |
T |
 |
| Q |
213 |
cattagctagggcttgaattttttcattagtgaaccccccgatcaggggag |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42643187 |
cattagctagggcttgaattttttcattagtgaaccccccgatcaggggag |
42643137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University