View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0730_high_16 (Length: 292)

Name: NF0730_high_16
Description: NF0730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0730_high_16
NF0730_high_16
[»] chr7 (1 HSPs)
chr7 (13-263)||(42643137-42643387)


Alignment Details
Target: chr7 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 13 - 263
Target Start/End: Complemental strand, 42643387 - 42643137
Alignment:
13 aatatcataccacacacacgaaggacagactcacaagtaataaagagacgacacataaactcttgcattaaacgacnnnnnnncaccttatttctcgaaa 112  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||    
42643387 aatatcataccacacacacaaaggacagactcacaagtaataaagagacgacacataaactcttgcattaaacgacaaaaaaacaccttatttctcgaaa 42643288  T
113 atcaccatgtgatgcaggaggtttgcccgaacatgtgctctatctaaatgcaattgccatgaaaaaacaatgactttagaaggtgatgtactcgtccaaa 212  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
42643287 atcaccatgtgatgcaggaggtttgcccgaacatgtgctctatctaaatgcaattgccatgaaaaaacaatgactttagaaggtgatggactcgtccaaa 42643188  T
213 cattagctagggcttgaattttttcattagtgaaccccccgatcaggggag 263  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||    
42643187 cattagctagggcttgaattttttcattagtgaaccccccgatcaggggag 42643137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 4606 times since January 2019
Visitors: 4836