View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0730_high_17 (Length: 275)
Name: NF0730_high_17
Description: NF0730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0730_high_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 16 - 239
Target Start/End: Complemental strand, 54609634 - 54609416
Alignment:
| Q |
16 |
atcaattgtctagaagtgttaatcattatgtttgttggaacgtacgtgtaatgcagtttctaagtatacattgttatccttttcatacgaaacgaaactt |
115 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
54609634 |
atcaattgtctagaagtgtcaatcattatgtttgttggcacgtacgtgtaatgcagtttctaagtatacattgttatccttttcatacgaaac-----tc |
54609540 |
T |
|
| Q |
116 |
tgcagatacaattgcgatagaaacctcgtaaaatatatggtcaaattttatggggaagatgctttgaaataagttaaaatcatgcaaatacgtgaactct |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54609539 |
tgcagatacaattgcgatagaaacctcgtaaaatatatggtcaaattttatggggaagatgctttgaaataagttaaaatcatgcaaatacgtgaactct |
54609440 |
T |
|
| Q |
216 |
aggtcatttcactgacactatata |
239 |
Q |
| |
|
||||||||||||||||||| |||| |
|
|
| T |
54609439 |
aggtcatttcactgacactgtata |
54609416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3933 times since January 2019
Visitors: 4824