View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0730_high_5 (Length: 481)
Name: NF0730_high_5
Description: NF0730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0730_high_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 109; Significance: 1e-54; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 39 - 187
Target Start/End: Complemental strand, 7538705 - 7538549
Alignment:
Q |
39 |
atcaaatcaagcttgagtcttgcaaagactaattcagtctagtcta----------ttctcatctcagtaaaagttagtcataaataattctcctgaatg |
128 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7538705 |
atcaaatcaagcttgagtcttgcaaagactaattcagtctagtctagtctagtctattctcatctcagtaaaagttagtcataaataattctcctgaatg |
7538606 |
T |
 |
Q |
129 |
atttctataaacctgcctgaattcattcctctccaaatgcacaactattatgagacagt |
187 |
Q |
|
|
|||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||| |
|
|
T |
7538605 |
atttctataaacctgcttgaattcattc--ctccaaatgcacaactattatgagacagt |
7538549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 107; E-Value: 2e-53
Query Start/End: Original strand, 236 - 350
Target Start/End: Complemental strand, 7538500 - 7538386
Alignment:
Q |
236 |
tcactcaccataaccaaatatggcagagataatagtggcagctaacacacaagcacaagcatgcttgttgagatggtttacatccccacaagtgttttcc |
335 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||| |
|
|
T |
7538500 |
tcactcaccataaccaaatatggcagagataatagtggcagctaacacacaagcacaagcatgcttgttgagatggtttacatccccacacgtgctttcc |
7538401 |
T |
 |
Q |
336 |
atggatgatacttgg |
350 |
Q |
|
|
||||||||||||||| |
|
|
T |
7538400 |
atggatgatacttgg |
7538386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University