View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0730_high_8 (Length: 387)
Name: NF0730_high_8
Description: NF0730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0730_high_8 |
 | |
|
| [»] scaffold0232 (1 HSPs) |
| | |
|
Alignment Details
Target: chr4 (Bit Score: 227; Significance: 1e-125; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 377
Target Start/End: Complemental strand, 42392371 - 42391989
Alignment:
| Q |
1 |
gggaaagaggttcatacca-ggtgttgagtgacctaatggatatacttcttgttaagttgttataactaggagtgtgcatggttcataaaccaaaccaaa |
99 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
42392371 |
gggaaagaggttcataccaaggtgttgagtgacgtaatggttatacttcttgttaagttgttataactaggagtgtgcatggttcataaatcaaaccaaa |
42392272 |
T |
|
| Q |
100 |
ccatatccaatttatggtttggtttcttaaactgtttcagaaaaaaccaannnnnnn-acgaaacagttcaggtttgctttgggtccggttcagaaccgg |
198 |
Q |
| |
|
|||||| ||||||||||||||||||||||| ||||||||||||||||||| |||||| |||||| ||||| ||||||||||||||||||| || |
|
|
| T |
42392271 |
ccatattcaatttatggtttggtttcttaacctgtttcagaaaaaaccaattttttttacgaaatagttcaagtttgttttgggtccggttcagaactgg |
42392172 |
T |
|
| Q |
199 |
tttgtgttnnnnnnn---gcggtttatttattttaccagtttctcaaacagtttccatggcttcccttcttagcttcttgaagtttatcttgccttttct |
295 |
Q |
| |
|
|||| || |||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
42392171 |
tttgcattaaaaaaaaaagcggtttattcattttaccagtttctcaaacagttttcatggcttcccttcttagcttcttgaagtttatcttgccttgtct |
42392072 |
T |
|
| Q |
296 |
aaggttgttttaaggatgttagttctaggtcattttgatgatgtttcattagt-atgtaagtaaatgattaatttagtctctg |
377 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||| || | |||||||||| | ||||||||||| |
|
|
| T |
42392071 |
aaggtagttttaaggatgttagttctaggtcattttgatgatgtttcattagtaatttgagtaaatgatcactttagtctctg |
42391989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 67 - 100
Target Start/End: Complemental strand, 4010623 - 4010590
Alignment:
| Q |
67 |
taggagtgtgcatggttcataaaccaaaccaaac |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
4010623 |
taggggtgtgcatggttcataaaccaaaccaaac |
4010590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0232 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0232
Description:
Target: scaffold0232; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 73 - 102
Target Start/End: Original strand, 21423 - 21452
Alignment:
| Q |
73 |
tgtgcatggttcataaaccaaaccaaacca |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
21423 |
tgtgcatggttcataaaccaaaccaaacca |
21452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 59 - 100
Target Start/End: Original strand, 7528122 - 7528163
Alignment:
| Q |
59 |
gttataactaggagtgtgcatggttcataaaccaaaccaaac |
100 |
Q |
| |
|
|||||||||||| ||||||||| ||||| ||||||||||||| |
|
|
| T |
7528122 |
gttataactaggggtgtgcatgattcatgaaccaaaccaaac |
7528163 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2661 times since January 2019
Visitors: 4796