View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0730_low_1 (Length: 737)
Name: NF0730_low_1
Description: NF0730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0730_low_1 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 164; Significance: 3e-87; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 164; E-Value: 3e-87
Query Start/End: Original strand, 300 - 522
Target Start/End: Complemental strand, 44501463 - 44501241
Alignment:
Q |
300 |
aagttggtgtcttgtcttgttttagcaaagagaggatctagagagagcgtgttctgttctttgataagactttcaaacatcatggtcagcacctaactct |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44501463 |
aagttggtgtcttgtcttgttttagcaaagagaggatctagagagagcgtgttctgttctttgataagactttcaaacatcatggtcagcacctaactct |
44501364 |
T |
 |
Q |
400 |
tgttcttgttcctcttcatctaatcttaatctttgatactcactacctacctcttgtttctttcnnnnnnnnnnnnnnnnncttagattctcatgttcta |
499 |
Q |
|
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
44501363 |
tgttcttgttcctcttcatataatcttaatctttgatactcactacctacctcttgtttctttcttttattttttatttttcttagattctcatgttcta |
44501264 |
T |
 |
Q |
500 |
aaccgaaacttccaggcccagaa |
522 |
Q |
|
|
||||||||||||||| ||||||| |
|
|
T |
44501263 |
aaccgaaacttccagacccagaa |
44501241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 116; E-Value: 1e-58
Query Start/End: Original strand, 562 - 727
Target Start/End: Complemental strand, 44501201 - 44501036
Alignment:
Q |
562 |
ataatcactgaatcatggttttgtgaaatttatatttgggtattttcagnnnnnnnacagttattttatgtatttgcaaaaacataaaaaggtaactgnn |
661 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
44501201 |
ataatcactgaatcatggttttgtgaaatttatatttgggtattttcagtttttttacagttattttatgtatttgcaaaaacataaaaaggttactgtt |
44501102 |
T |
 |
Q |
662 |
nnnnncgacaaaaaaggttactgttttgttgatgtaggaatcttctaggttcttcttatatctgtg |
727 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
44501101 |
tttttcgacaaaaaaggttactgttttgttgatgtaggaatcttctatgttcttcttatatctgtg |
44501036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 83; E-Value: 6e-39
Query Start/End: Original strand, 191 - 273
Target Start/End: Complemental strand, 44501572 - 44501490
Alignment:
Q |
191 |
ccttgtttcatttgttggatttaacgaagtcttcgagtccgtgtttcatttccatttcatccagagtcagcttatttgtttgt |
273 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44501572 |
ccttgtttcatttgttggatttaacgaagtcttcgagtccgtgtttcatttccatttcatccagagtcagcttatttgtttgt |
44501490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 48 - 127
Target Start/End: Complemental strand, 44501715 - 44501636
Alignment:
Q |
48 |
tgtgtcgtgttcgatgactgtgtttgtatccatatttgatcgccgcaaacaaagctttacatatgtggattcatataacc |
127 |
Q |
|
|
|||||||||||||||| || ||||||||||| ||||||||| |||||||||||| ||||| ||||||||||||||||| |
|
|
T |
44501715 |
tgtgtcgtgttcgatgtacgtatttgtatccatgtttgatcgctgcaaacaaagctatacatttgtggattcatataacc |
44501636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2758 times since January 2019
Visitors: 4801