View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0730_low_16 (Length: 362)
Name: NF0730_low_16
Description: NF0730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0730_low_16 |
 |  |
|
[»] scaffold0041 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 1 - 276
Target Start/End: Original strand, 21625179 - 21625455
Alignment:
Q |
1 |
gtagtaatttaaaaatgtatttttatttagagatattttttcccctaaaaattgcttctaaaacgagacattgagtaatagtgttaattaaaccatttta |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||| |||| |
|
|
T |
21625179 |
gtagtaatttaaaaatgtatttttatttagagatattttttcccctaaaaattgcttgtaaaacgagacattgagtaatagtgttaataaaaccgttttt |
21625278 |
T |
 |
Q |
101 |
t-ggatattgtttgatgtcttaaaaaggtgtcaagaaatattgatttggtttatggaggaggtagcattggtttgatggggttggtttctcaagctgttt |
199 |
Q |
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
T |
21625279 |
ttggatattgtttgatgtcttaaaaaggtgtcaagaaatattgatttggtttatggaggaggcagcattggtttgatggggttggtttctcaagctgttt |
21625378 |
T |
 |
Q |
200 |
ctgatggaggtcgacatgtgattgggtgagaaatgagcatcttcttccttatgatcgatttgtcttggtgatgatgt |
276 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
21625379 |
ctgatggaggtcgacatgtgattgggtgagaaatgagcatcttcttccttatgatcgatttgtcttggtgatgatgt |
21625455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 75; Significance: 2e-34; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 120 - 226
Target Start/End: Complemental strand, 40465903 - 40465797
Alignment:
Q |
120 |
taaaaaggtgtcaagaaatattgatttggtttatggaggaggtagcattggtttgatggggttggtttctcaagctgtttctgatggaggtcgacatgtg |
219 |
Q |
|
|
|||||||||||||||||||||||| | |||||||||||||| ||||||||||||||||||||| ||||||||||||||| |||||| ||||||||||| |
|
|
T |
40465903 |
taaaaaggtgtcaagaaatattgacctagtttatggaggaggcagcattggtttgatggggttgatttctcaagctgtttatgatggtggtcgacatgta |
40465804 |
T |
 |
Q |
220 |
attgggt |
226 |
Q |
|
|
||||||| |
|
|
T |
40465803 |
attgggt |
40465797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 47; Significance: 9e-18; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 124 - 198
Target Start/End: Complemental strand, 28271509 - 28271435
Alignment:
Q |
124 |
aaggtgtcaagaaatattgatttggtttatggaggaggtagcattggtttgatggggttggtttctcaagctgtt |
198 |
Q |
|
|
||||||||||||||||||||| | |||||||||||||| ||||||||| | ||||| |||||||| ||||||||| |
|
|
T |
28271509 |
aaggtgtcaagaaatattgatctagtttatggaggaggaagcattggtctaatgggtttggtttcacaagctgtt |
28271435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 136 - 179
Target Start/End: Original strand, 7884265 - 7884308
Alignment:
Q |
136 |
aatattgatttggtttatggaggaggtagcattggtttgatggg |
179 |
Q |
|
|
|||||||| ||||| ||||||||||| ||||||||||||||||| |
|
|
T |
7884265 |
aatattgacttggtatatggaggaggaagcattggtttgatggg |
7884308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0041 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: scaffold0041
Description:
Target: scaffold0041; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 124 - 226
Target Start/End: Original strand, 77216 - 77318
Alignment:
Q |
124 |
aaggtgtcaagaaatattgatttggtttatggaggaggtagcattggtttgatggggttggtttctcaagctgtttctgatggaggtcgacatgtgattg |
223 |
Q |
|
|
||||| ||||| || |||||| | || ||||||||||| ||||||||| | ||||| || ||||||||||||||| |||||| ||||| ||||| |||| |
|
|
T |
77216 |
aaggtttcaaggaacattgatcttgtgtatggaggaggaagcattggtctcatgggtttagtttctcaagctgttcatgatggtggtcgccatgtcattg |
77315 |
T |
 |
Q |
224 |
ggt |
226 |
Q |
|
|
||| |
|
|
T |
77316 |
ggt |
77318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 124 - 226
Target Start/End: Complemental strand, 40889068 - 40888966
Alignment:
Q |
124 |
aaggtgtcaagaaatattgatttggtttatggaggaggtagcattggtttgatggggttggtttctcaagctgtttctgatggaggtcgacatgtgattg |
223 |
Q |
|
|
||||| ||||| || |||||| | || ||||||||||| ||||||||| | ||||| || ||||||||||||||| |||||| ||||| ||||| |||| |
|
|
T |
40889068 |
aaggtttcaaggaacattgatcttgtgtatggaggaggaagcattggtctcatgggtttagtttctcaagctgttcatgatggtggtcgccatgtcattg |
40888969 |
T |
 |
Q |
224 |
ggt |
226 |
Q |
|
|
||| |
|
|
T |
40888968 |
ggt |
40888966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3673 times since January 2019
Visitors: 4818