View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0730_low_28 (Length: 252)
Name: NF0730_low_28
Description: NF0730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0730_low_28 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 248
Target Start/End: Original strand, 39529176 - 39529423
Alignment:
| Q |
1 |
aaagaaaatgcaaaagttgaaaccgaaacaacatgacaaagaagatatatttctattttaagtaaccttgcatgataagttggtaacagacataaacaag |
100 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39529176 |
aaagaaaatgcaaaagttgaaacctaaacaacatggcaaagaagatatgtttctattttaagtaaccttgcatgataagttggtaacagacataaacaag |
39529275 |
T |
 |
| Q |
101 |
gagcattacaaactaagcatccttaacgtatcgcatccgatactcatatcttgtttgtgcttcatcgacaaaaatggcaaaaatgtcataaatatgatcc |
200 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
39529276 |
gagcattacaaactaagtatccttaacgtatcgcatccgatactcatatcttgtttgtgcttcgtcgacaaaaatggcaaaaatgtcataaatatgatcc |
39529375 |
T |
 |
| Q |
201 |
cttgaaaataattcctacaattgctaataaaagctcttcatctcactc |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
39529376 |
cttgaaaataattcctacaattgctaataaaagctcttcttctcactc |
39529423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University