View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0730_low_32 (Length: 203)
Name: NF0730_low_32
Description: NF0730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0730_low_32 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 180
Target Start/End: Complemental strand, 40303816 - 40303636
Alignment:
| Q |
1 |
ccacaccttttgcatctcctctgggtttgagggtaccgacaagggataaggttggaaatgtcaaacaaattgaagaagagagaa-gggtgcaaccacaga |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
40303816 |
ccacaccttttgcatctcctctgggtttgagggtaccgacaagggatgaggttggaaatgtcaaacaaattgaagaagagagaaagggtgcaaccacaga |
40303717 |
T |
|
| Q |
100 |
tgataaggtgattttggaaatgtttaagcatactgaagaagatggaaaaaacaattttgttattccagtggatgttgatga |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
40303716 |
tgataaggtgattttggaaatgtttaagcatactgaagaagatggaaaaaacgattttgttattccagtggatgttgatga |
40303636 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 3 - 180
Target Start/End: Complemental strand, 8048310 - 8048132
Alignment:
| Q |
3 |
acaccttttgcatctcctctgggtttgagggtaccgacaagggataaggttggaaatgtcaaacaaattgaagaagagagaa-gggtgcaaccacagatg |
101 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| || ||| ||||||||| ||||||||||||||||||||| | || ||||||||||||||||| |
|
|
| T |
8048310 |
acaccttttgcatctcctctaggtttgagggtaccgacgagtgatgaggttggaagtgtcaaacaaattgaagaagacataaagggtgcaaccacagatg |
8048211 |
T |
|
| Q |
102 |
ataaggtgattttggaaatgtttaagcatactgaagaagatggaaaaaacaattttgttattccagtggatgttgatga |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||| ||| | |||||||||||| ||||||||||||| |
|
|
| T |
8048210 |
ataaggtgattttggaaatgtttaagcatactgaagaagatagaaataacgactttgttattccattggatgttgatga |
8048132 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 65; Significance: 9e-29; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 3 - 127
Target Start/End: Original strand, 31635108 - 31635235
Alignment:
| Q |
3 |
acaccttttgcatctcctctgggtttgagggtaccgacaagggataaggttggaaatgtcaaacaaattgaagaagaga-gaagg--gtgcaaccacaga |
99 |
Q |
| |
|
|||| ||||||||||| ||| ||||||||||||||||| || ||| ||||||||| ||||||||||||||||||||| | ||||| ||||||||| ||| |
|
|
| T |
31635108 |
acacattttgcatctcttctaggtttgagggtaccgacgagtgatgaggttggaagtgtcaaacaaattgaagaagacaggaagggtgtgcaaccataga |
31635207 |
T |
|
| Q |
100 |
tgataaggtgattttggaaatgtttaag |
127 |
Q |
| |
|
|||| ||||||||| ||||||||||||| |
|
|
| T |
31635208 |
tgatgaggtgatttgggaaatgtttaag |
31635235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2958 times since January 2019
Visitors: 4805