View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0731_low_13 (Length: 288)
Name: NF0731_low_13
Description: NF0731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0731_low_13 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 1 - 260
Target Start/End: Original strand, 30001124 - 30001382
Alignment:
Q |
1 |
gttgagtgcaaaggaggatcctgaagctgtgcagattgaagctgtgaagcagattagtttggggtcttgtgatcctgataatacaccagctgaaattgtg |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
30001124 |
gttgagtgcaaaggaggatcctgaagctgtgcagattgaagctgtgaagcagattagtttggggtcttgtgatcctgataatacaccagctgaaattgtg |
30001223 |
T |
 |
Q |
101 |
gcatacagatactgggtgagttactttgttcattttaagcacattgactttaggttgaggatattggaacttggaagatataagtttcaagtttgattgt |
200 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
30001224 |
gcatacagatactgggtgagttactttgttcattttaagcacattgactttaggttgaggatattggaacttggaagatat-agtttcaagtttgattgt |
30001322 |
T |
 |
Q |
201 |
tatgttattcttaaagaaatatgagtcttttagaagtttgtggagaatttcagatgtgtt |
260 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
30001323 |
tatgttattcttaaagaaatatgagtcttttagaagtttgcggagaatttcagatgtgtt |
30001382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 67; Significance: 8e-30; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 3 - 117
Target Start/End: Original strand, 45199247 - 45199361
Alignment:
Q |
3 |
tgagtgcaaaggaggatcctgaagctgtgcagattgaagctgtgaagcagattagtttggggtcttgtgatcctgataatacaccagctgaaattgtggc |
102 |
Q |
|
|
||||||||||||||||||| || ||||| |||||||||||||| ||||| || |||||||| |||||| | ||||||||||||||||||||| |||| || |
|
|
T |
45199247 |
tgagtgcaaaggaggatcccgaggctgtacagattgaagctgttaagcaaatcagtttgggatcttgtcaccctgataatacaccagctgaagttgtcgc |
45199346 |
T |
 |
Q |
103 |
atacagatactgggt |
117 |
Q |
|
|
|||| |||||||||| |
|
|
T |
45199347 |
ataccgatactgggt |
45199361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University