View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0731_low_14 (Length: 282)
Name: NF0731_low_14
Description: NF0731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0731_low_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 34588276 - 34588502
Alignment:
Q |
1 |
ttataaataatacaaaaaacacttcaaaaaatttagaagagaaaa-agttatcagcttcatgatgcaggagagattaccaaatatgtattacgcacacaa |
99 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34588276 |
ttataaataatacaaaaaacacttcaaaaaatttagaagagaaaaaagttatcagcttcatgatgcaggagagattaccaaatatgtattacgcacacaa |
34588375 |
T |
 |
Q |
100 |
cttatctagattaattgaaaaactatctacaaattttcaagcattgttctttgttttctgagcatatgtttattaacatcaaccataagcagaagtgaaa |
199 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
34588376 |
cttatctagattaattgaaaaactatctacaaattttcaagcattgttctttgttttctgaacatatgtttattaacatcaaccataagcagaagtgaaa |
34588475 |
T |
 |
Q |
200 |
agaacacataaaggatagagtatcaac |
226 |
Q |
|
|
||||||||||||||||||||||||||| |
|
|
T |
34588476 |
agaacacataaaggatagagtatcaac |
34588502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 244 - 275
Target Start/End: Original strand, 34588520 - 34588551
Alignment:
Q |
244 |
cttcttccgacgctcttcatcactctctgctc |
275 |
Q |
|
|
|||||||||||||||||||||||||||||||| |
|
|
T |
34588520 |
cttcttccgacgctcttcatcactctctgctc |
34588551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3821 times since January 2019
Visitors: 4822