View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0731_low_9 (Length: 321)
Name: NF0731_low_9
Description: NF0731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0731_low_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 36333574 - 36333334
Alignment:
| Q |
1 |
caggaattggtattatcaataaagtatcatccattcaaattacaaaatagactgaacacaaaaacaccgcagcaggattactagcggactttccactcag |
100 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
36333574 |
caggaattggtattatcaacaaagtatcatccattcaaattacaaaatagactgaacacaaaaacaccgcagcaggattacaagcggactttccactcag |
36333475 |
T |
|
| Q |
101 |
ctaatatgaacctctgagaaaataaaggaaattataacaaatatttgacttcacaaaagagacagaactcaacagcattgttccaccaaaatatgaaaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
36333474 |
ctaatatgaacctctgagaaaataaaggaaattataacaaatatttgacttcacaaaagagacagaactcaacagcattgctccaccaaaatatgaaaat |
36333375 |
T |
|
| Q |
201 |
gactacctttggctttgctactaaacattcctgcaacagct |
241 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36333374 |
gaatacctttggctttgctactaaacattcctgcaacagct |
36333334 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3130 times since January 2019
Visitors: 4805