View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0732_high_2 (Length: 290)
Name: NF0732_high_2
Description: NF0732
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0732_high_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 9 - 271
Target Start/End: Original strand, 21601074 - 21601336
Alignment:
Q |
9 |
agcagagacgtgtttacaaaatgtgtggataaacactgaatttcatgatttcattgtagccatagaaaaaacccttttatcaatttaccattttgttcct |
108 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
T |
21601074 |
agcagagacgtgtttacaaaatgtgtggataaacactgaatttcatgatttcattgtagccatagaaaaaacccttttatcaatttaacattttgttcct |
21601173 |
T |
 |
Q |
109 |
taacataacacattcacaaactccaagcatgcaatccatggctgtaaccaccacaacatggaagctcgcactgttcttgactcttatctcagtttcatta |
208 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
21601174 |
taacataacacattcacaaactccaagcatgcaatccatggctgtaacaaccacaacatggaagcttgcactgttcttgactcttatctcagtttcatta |
21601273 |
T |
 |
Q |
209 |
tcaggcactctttcatatgatattgtaccatgcaaacgcatagagtgtcctaatgatgatgtc |
271 |
Q |
|
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
T |
21601274 |
tcaggtactctttcatatgatattgtaccatgcaaacgcatagagtgtcctaactatgatgtc |
21601336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University