View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0732_low_10 (Length: 254)
Name: NF0732_low_10
Description: NF0732
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0732_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 23 - 146
Target Start/End: Complemental strand, 36826373 - 36826250
Alignment:
Q |
23 |
atcatcacgggaactaatccaaataagcctatcattagcatctgcatcaattattgaattatgaatatgatcttgattgacttgaggaagttgagtatac |
122 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||| |||||||||| ||||||||||||||||||| |
|
|
T |
36826373 |
atcatcacgggaactaatccaaataagcctatcattagtatctgcatcaattattaaattatgaatatgttcttgattgaattgaggaagttgagtatac |
36826274 |
T |
 |
Q |
123 |
aagatgttagagttccaaacctca |
146 |
Q |
|
|
|||||||||||||||||||||||| |
|
|
T |
36826273 |
aagatgttagagttccaaacctca |
36826250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 148 - 251
Target Start/End: Complemental strand, 36826214 - 36826111
Alignment:
Q |
148 |
catttggatccaaagcttttgagattgatgtaaaatgtcccatatatgcttgcccaatagagatatattagagtgtctcgaagcagtggcggatccagga |
247 |
Q |
|
|
|||||||||||||||||| || ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||| ||| | |
|
|
T |
36826214 |
catttggatccaaagcttatgggattgatgtaaaatgtcccatatatgcctgcccaatagagatatattagagtgtctcgaagcaatggcggattcagaa |
36826115 |
T |
 |
Q |
248 |
ttat |
251 |
Q |
|
|
|||| |
|
|
T |
36826114 |
ttat |
36826111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 148 - 218
Target Start/End: Complemental strand, 34535734 - 34535664
Alignment:
Q |
148 |
catttggatccaaagcttttgagattgatgtaaaatgtcccatatatgcttgcccaatagagatatattag |
218 |
Q |
|
|
|||||||| |||||||||||| | |||||| | ||||||||| ||||||||| | | |||||| ||||||| |
|
|
T |
34535734 |
catttggacccaaagcttttgtggttgatgcagaatgtcccaaatatgcttgtctagtagagagatattag |
34535664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University