View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0732_low_11 (Length: 250)
Name: NF0732_low_11
Description: NF0732
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0732_low_11 |
 | |
|
| [»] scaffold0137 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0137 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: scaffold0137
Description:
Target: scaffold0137; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 88 - 226
Target Start/End: Complemental strand, 7595 - 7457
Alignment:
| Q |
88 |
tcatcatcaaccctctctcctcaccttcgacgtggaaccctcactgaaaccctttctcaccgtgaaacattcaacatcaaccctaaccctcaccaaaaac |
187 |
Q |
| |
|
||||||||||||||||||||| ||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7595 |
tcatcatcaaccctctctccttaccgtcgatgtggaaccctcactgaaaccctttctcaccgtgaaacattcaacatcaaccctaaccctcaccaaaaac |
7496 |
T |
|
| Q |
188 |
ttccattcactacttttattaacttatattaccacttgt |
226 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
7495 |
tttcattcactacttttattaacttatattaccacttgt |
7457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 119; Significance: 7e-61; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 86 - 212
Target Start/End: Complemental strand, 3900456 - 3900330
Alignment:
| Q |
86 |
catcatcatcaaccctctctcctcaccttcgacgtggaaccctcactgaaaccctttctcaccgtgaaacattcaacatcaaccctaaccctcaccaaaa |
185 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3900456 |
catcatcatcaaccctctctcctcaccgtcgacgtggaaccctcactgaaaccctttctcaccgtgaaacattcaacatcaaccctaaccctcaccaaaa |
3900357 |
T |
|
| Q |
186 |
acttccattcactacttttattaactt |
212 |
Q |
| |
|
|||| |||||||||||||||||||||| |
|
|
| T |
3900356 |
actttcattcactacttttattaactt |
3900330 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2954 times since January 2019
Visitors: 4805