View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0732_low_6 (Length: 282)
Name: NF0732_low_6
Description: NF0732
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0732_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 29 - 272
Target Start/End: Original strand, 39225491 - 39225734
Alignment:
| Q |
29 |
aaaaagaaggataaattaggctcatatctaatcttttaaagcacatttgaatagtggaattcagctgtaacatatttgttcactgaaaatggagggcata |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39225491 |
aaaaagaaggataaattaggctcatatctaatcttttaaagcacatttgaatagtggaattcagctgtaacatatttgttcactgaaaatggagggcata |
39225590 |
T |
|
| Q |
129 |
aacatcttctcatcttccctcatccataagtaatgttaactcccatatatcaaataacatcaacgacatgtattatttccatgttatacttggctatttc |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
39225591 |
aacatcttctcatcttccctcatccataagtaatgttaactcccatatatcaaataacatcaacgacatgtattatttccatgtcatacttggctatttc |
39225690 |
T |
|
| Q |
229 |
tcatttccctatctaatgtcaaccatgatactgtgtaccctatg |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39225691 |
tcatttccctatctaatgtcaaccatgatactgtgtaccctatg |
39225734 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2722 times since January 2019
Visitors: 4801