View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0732_low_7 (Length: 262)
Name: NF0732_low_7
Description: NF0732
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0732_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 23 - 233
Target Start/End: Original strand, 32550384 - 32550594
Alignment:
| Q |
23 |
catcaaattaaaaagagaagtatcgaaccaaaactacattcatgaaagtttcaagcttaagtcttcacttaaatacaattatagcatgcatatgttgata |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
32550384 |
catcaaattaaaaagagaagtatcgaaccaaaactacattcatgaaagtttcaagcttaagtcttcactgaaatacaattatagcatgcatatgttgata |
32550483 |
T |
 |
| Q |
123 |
ttatttcgccaatccacacaattcaaatcataaaattcatcgacaaccctaatcctaaagacagtgttctcaatgaatttcgctcgaccacttacaatag |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32550484 |
ttatttcgccaatccacacaattcaaatcataaaattcatcgacaaccctaatcctaaagacagtgttctcaatgaatttcgctcgaccacttacaatag |
32550583 |
T |
 |
| Q |
223 |
cccgtcaaatc |
233 |
Q |
| |
|
||||||||||| |
|
|
| T |
32550584 |
cccgtcaaatc |
32550594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University