View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0733_high_13 (Length: 510)
Name: NF0733_high_13
Description: NF0733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0733_high_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 90; Significance: 3e-43; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 90; E-Value: 3e-43
Query Start/End: Original strand, 202 - 299
Target Start/End: Original strand, 43912204 - 43912301
Alignment:
Q |
202 |
ggggttgggattgagtttgtaacttgagacagcaatgttggtatatgtcatatgttttgcaatattttcccctcggttcataatttccttggatgaac |
299 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
43912204 |
ggggttgggattgagtttgtaacttgagacagcaatgttggtatatgtcatatgttttgcaatattttccctccggttcataatttccttggatgaac |
43912301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 88; E-Value: 4e-42
Query Start/End: Original strand, 18 - 145
Target Start/End: Original strand, 43912022 - 43912147
Alignment:
Q |
18 |
aatgttcagcttaatcgtggattattgaataatctaggccacaatttatgtatgtgacctttggttggtttgattcctgtcctcctaaagcaagagtaga |
117 |
Q |
|
|
|||||||||||||||||||||||||||||||||| || | ||||||| |||| |||||||| | ||||||||||||||| |||||||||||||||||||| |
|
|
T |
43912022 |
aatgttcagcttaatcgtggattattgaataatccag-ctacaatttttgtacgtgacctt-gattggtttgattcctggcctcctaaagcaagagtaga |
43912119 |
T |
 |
Q |
118 |
agaagcttctcacacacaaaggtaaagt |
145 |
Q |
|
|
|||||||||||||||||||||||||||| |
|
|
T |
43912120 |
agaagcttctcacacacaaaggtaaagt |
43912147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 313 - 413
Target Start/End: Original strand, 43912340 - 43912440
Alignment:
Q |
313 |
acatctcaatcactttttggtgtcatccaggtattcttggacttctagagaaattgaagatgcagaaaatgcttccttgctcgtggctgctgatgttatt |
412 |
Q |
|
|
||||||||||||||| || ||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||| |
|
|
T |
43912340 |
acatctcaatcacttcatgctgtaatccaggtattcttggacttctagagaaattgaagatgcagaaaatgcttctttgctcctggctgctgatgttatt |
43912439 |
T |
 |
Q |
413 |
t |
413 |
Q |
|
|
| |
|
|
T |
43912440 |
t |
43912440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 88; Significance: 4e-42; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 88; E-Value: 4e-42
Query Start/End: Original strand, 318 - 413
Target Start/End: Complemental strand, 3385064 - 3384969
Alignment:
Q |
318 |
tcaatcactttttggtgtcatccaggtattcttggacttctagagaaattgaagatgcagaaaatgcttccttgctcgtggctgctgatgttattt |
413 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||| |
|
|
T |
3385064 |
tcaatcactttttggtgtcatccaggtattcttggacttctagagaaattgaagatgcagaaaatgcttcctcgctcctggctgctgatgttattt |
3384969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4984 times since January 2019
Visitors: 4844