View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0733_high_15 (Length: 500)

Name: NF0733_high_15
Description: NF0733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0733_high_15
NF0733_high_15
[»] chr5 (1 HSPs)
chr5 (13-90)||(13864030-13864107)


Alignment Details
Target: chr5 (Bit Score: 74; Significance: 1e-33; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 13 - 90
Target Start/End: Original strand, 13864030 - 13864107
Alignment:
13 tttgttgaataaaatcagtgataaaggataaaaaatttacactaaattctaaactaatttttccactttaaattttca 90  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
13864030 tttgttgaataaaatcagtgataaaggataaaaaatttacactaaattctaaactaatttttccactttaaactttca 13864107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 4318 times since January 2019
Visitors: 4832