View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0733_high_15 (Length: 500)
Name: NF0733_high_15
Description: NF0733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0733_high_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 74; Significance: 1e-33; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 13 - 90
Target Start/End: Original strand, 13864030 - 13864107
Alignment:
| Q |
13 |
tttgttgaataaaatcagtgataaaggataaaaaatttacactaaattctaaactaatttttccactttaaattttca |
90 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
13864030 |
tttgttgaataaaatcagtgataaaggataaaaaatttacactaaattctaaactaatttttccactttaaactttca |
13864107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University