View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0733_high_19 (Length: 439)
Name: NF0733_high_19
Description: NF0733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0733_high_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 319; Significance: 1e-180; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 96 - 430
Target Start/End: Complemental strand, 35337675 - 35337341
Alignment:
Q |
96 |
ttacggagtagtccttttggagttacttacaggcaagaagccagtccaatcattggatcaaggtggtggtgatctcgtaacatgggtgacaaacaatatc |
195 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
35337675 |
ttacggagtagtccttttggagttacttacaggcaagaagccagtccaatcattggatcaaggtggtggtgatctcgtaacatgggtgacaaataatatc |
35337576 |
T |
 |
Q |
196 |
aacaaatattcattgaaactagacaacatccttgatgcaaaattggacctactacatgaaattgatgttgcacaagtatttgatgtcttaaaaattgctt |
295 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35337575 |
aacaaatattcattgaaactagacaacatccttgatgcaaaattggacctactacatgaaattgatgttgcacaagtatttgatgtcttaaaaattgctt |
35337476 |
T |
 |
Q |
296 |
taatgtgcaccgacaactctccttctagacgcccaactatgcgtaaagtcgtatcaatgcttacaagttctagtcaacggaaagagcaatctttgttatc |
395 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35337475 |
taatgtgcaccgacaactctccttctagacgcccaactatgcgtaaagttgtctcaatgcttacaagttctagtcaacggaaagagcaatctttgttatc |
35337376 |
T |
 |
Q |
396 |
tccatgtcaagaatcaagtaacatagaagaataat |
430 |
Q |
|
|
||||||||||||||||||||| ||||||||||||| |
|
|
T |
35337375 |
tccatgtcaagaatcaagtaatatagaagaataat |
35337341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4268 times since January 2019
Visitors: 4832