View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0733_high_30 (Length: 347)
Name: NF0733_high_30
Description: NF0733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0733_high_30 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 1 - 319
Target Start/End: Complemental strand, 28676699 - 28676381
Alignment:
| Q |
1 |
tggggttgccggaaggctgaatgatttatgggcatttgatgttgtggatggcaagtgggtggaatttccatctcccggtgaaagttgcaagggaagaggt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
28676699 |
tggggttgccggaaggctgaatgatttatgggcatttgatgttgtggatggcaagtgggcggaattaccatctcccggtgaaagttgcaagggaagaggt |
28676600 |
T |
 |
| Q |
101 |
gggccgggcctaacagtggcccaaggaaaaatatgggttgtgtatggttttgctggaatggaagtggatgacgtgcatttcttcaacctggcccaaaaga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28676599 |
gggccgggcctaacagtggcccaaggaaaaatatgggttgtgtatggttttgctggaatggaagtggatgacgtgcatttcttcaacctggcccaaaaga |
28676500 |
T |
 |
| Q |
201 |
catgggcccaagtggaaacaagcgggctcaaaccaacggcccgtagcgtattttcaacctgtttgattgggaaacacataattgtatatggtggggaaat |
300 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28676499 |
catgggcccaagtggaaacaagtgggctcaaaccaacggcccgtagcgtgttttcaacctgtttgattgggaaacacataattgtatatggtggggaaat |
28676400 |
T |
 |
| Q |
301 |
agaccctagtgaccaaggt |
319 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
28676399 |
agaccctagtgaccaaggt |
28676381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University