View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0733_high_33 (Length: 338)
Name: NF0733_high_33
Description: NF0733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0733_high_33 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 73 - 323
Target Start/End: Original strand, 10750649 - 10750899
Alignment:
| Q |
73 |
ggctttggtggaaatgaatggagaaattttgtctttaacgacaacctaacttctccatcaatgagttcttatgaatttggaattaggcagtttaagtttt |
172 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
10750649 |
ggctttggtggaaatgaatggagaaatttcgtctttaacgacaacctaacttctccatcaatgagttcttatgaatttgaaattaggcaatttaagtttt |
10750748 |
T |
 |
| Q |
173 |
tggtagttcctcagcttgtttggggattaaacaatcagaaaatcgcgttcgcaagggcttgtcttactgctagaatgttgaatagaacccttttgatgcc |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10750749 |
tggtagttcctcagcttgtttggggattaaacaatcagaaaatcgcgttcgcaaggtcttgtcttactgctagaatgttgaatagaacccttttgatgcc |
10750848 |
T |
 |
| Q |
273 |
tagctttagtgcctccctattctacaaagaaatcgatcaattgcaaccgat |
323 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10750849 |
tagctttagtgcctccctattctacaaagaaatcgatcaattgcaaccgat |
10750899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 62; Significance: 9e-27; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 166 - 323
Target Start/End: Original strand, 32560321 - 32560478
Alignment:
| Q |
166 |
aagtttttggtagttcctcagcttgtttggggattaaacaatcagaaaatcgcgttcgcaagggcttgtcttactgctagaatgttgaatagaacccttt |
265 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||| || || || || || |||||||||||||||||||| ||||||||||| ||||| || | |
|
|
| T |
32560321 |
aagtttttggaggttcctcaaattgtttggggattaaacaaccaaaagattgcatttgcaagggcttgtcttactgcaagaatgttgaacagaacactat |
32560420 |
T |
 |
| Q |
266 |
tgatgcctagctttagtgcctccctattctacaaagaaatcgatcaattgcaaccgat |
323 |
Q |
| |
|
|||||||||| ||||||| ||| | || ||||| |||||||||| || |||||||| |
|
|
| T |
32560421 |
tgatgcctagtcttagtgcttccttgttttacaaggaaatcgatcttttacaaccgat |
32560478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 54; Significance: 6e-22; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 3 - 68
Target Start/End: Original strand, 2062720 - 2062785
Alignment:
| Q |
3 |
gtttctacattaacaagaaaatgaaatttacatttttcttatcatatgttattggttttgcaacag |
68 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| | ||||||||||||||||||||| |
|
|
| T |
2062720 |
gtttctacattaacaagaaaatgaaatttacaattttcttataacatgttattggttttgcaacag |
2062785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 10 - 68
Target Start/End: Original strand, 2058297 - 2058355
Alignment:
| Q |
10 |
cattaacaagaaaatgaaatttacatttttcttatcatatgttattggttttgcaacag |
68 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
2058297 |
cattaacaagaaaatgaaatttacaattttcttataatatgttattggttttgcaacag |
2058355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 21 - 68
Target Start/End: Original strand, 2054339 - 2054386
Alignment:
| Q |
21 |
aaatgaaatttacatttttcttatcatatgttattggttttgcaacag |
68 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
2054339 |
aaatgaaatttacaattttcttatcatatgttattggttttgcaacag |
2054386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University