View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0733_high_37 (Length: 320)
Name: NF0733_high_37
Description: NF0733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0733_high_37 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 5 - 227
Target Start/End: Complemental strand, 47245699 - 47245478
Alignment:
Q |
5 |
atgattcaccttaagagataaatttcttgcacaaatatgttaattgaagatctaattgcacattcatgactttgattcctaaagcggttagcccgcataa |
104 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47245699 |
atgattcaccttaagagataaatttcttgcacaaatatgttaattgaagatctaattgcgcattcatgactttgattcctaaagcggttagcccgcataa |
47245600 |
T |
 |
Q |
105 |
gttatcagattttcaactgattccttcattagttgtatttatatattcatttcatctcactcgacctttgtaaatagtagacaaattttggatgatatag |
204 |
Q |
|
|
|||||||||||||||||||||||| ||||||||||||||||||| || |||| |||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47245599 |
gttatcagattttcaactgattccatcattagttgtatttatatgtttatttaatctcattcgacctttgtaaatagtagacaaattttggatgatatag |
47245500 |
T |
 |
Q |
205 |
ttatcgctaagaaggtggttgat |
227 |
Q |
|
|
|||||| |||||||||||||||| |
|
|
T |
47245499 |
ttatcg-taagaaggtggttgat |
47245478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University