View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0733_high_37 (Length: 320)

Name: NF0733_high_37
Description: NF0733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0733_high_37
NF0733_high_37
[»] chr3 (1 HSPs)
chr3 (5-227)||(47245478-47245699)


Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 5 - 227
Target Start/End: Complemental strand, 47245699 - 47245478
Alignment:
5 atgattcaccttaagagataaatttcttgcacaaatatgttaattgaagatctaattgcacattcatgactttgattcctaaagcggttagcccgcataa 104  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
47245699 atgattcaccttaagagataaatttcttgcacaaatatgttaattgaagatctaattgcgcattcatgactttgattcctaaagcggttagcccgcataa 47245600  T
105 gttatcagattttcaactgattccttcattagttgtatttatatattcatttcatctcactcgacctttgtaaatagtagacaaattttggatgatatag 204  Q
    |||||||||||||||||||||||| ||||||||||||||||||| || |||| |||||| ||||||||||||||||||||||||||||||||||||||||    
47245599 gttatcagattttcaactgattccatcattagttgtatttatatgtttatttaatctcattcgacctttgtaaatagtagacaaattttggatgatatag 47245500  T
205 ttatcgctaagaaggtggttgat 227  Q
    |||||| ||||||||||||||||    
47245499 ttatcg-taagaaggtggttgat 47245478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 3381 times since January 2019
Visitors: 4813