View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0733_high_39 (Length: 297)
Name: NF0733_high_39
Description: NF0733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0733_high_39 |
 |  |
|
[»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 8 - 297
Target Start/End: Original strand, 47964936 - 47965205
Alignment:
Q |
8 |
ccaacaatatgtatccaaagttgcaaagtgaataataacttttgcaggagaaacagggaaatgtttaaaattattagatttttcgtgttaaagtttttac |
107 |
Q |
|
|
||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47964936 |
ccaacaaaatgtatccaaagttgaaaagtgaataataacttttgcaggagaaacagggaaatgtttaaaattattagatttttcgtgttaaagtttttac |
47965035 |
T |
 |
Q |
108 |
tatttatgtttctatttgttctaaatgtatatgcgttgttttaaattgaaattcaataaaaatatattactgtttgtcacacacatcaccacctttagaa |
207 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
T |
47965036 |
tatttatgtttctatttgttctaaatgtatatgcgttgttttaaattgaaattcaataaaaatatattaatgtttgtcacacacatcaccacctttagaa |
47965135 |
T |
 |
Q |
208 |
ttgatggtatggaagaaggttttctctcatataattgttggaacaccggtgtctagggatcatcatcaagctgagttttgagaacaacat |
297 |
Q |
|
|
|||| |||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
T |
47965136 |
ttga--------------------tctcatgtaattgttggaacaccggtgtctcgggatcatcatcaagctgagttttgagaacaacat |
47965205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3410 times since January 2019
Visitors: 4813