View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0733_high_49 (Length: 255)
Name: NF0733_high_49
Description: NF0733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0733_high_49 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 16 - 246
Target Start/End: Original strand, 26102673 - 26102903
Alignment:
| Q |
16 |
ataggacgttaattttgatagaactcgttggcatataaaataatatctgattatcgtcaaaatttgtagacataattcaaattcacattggccacaaact |
115 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
26102673 |
ataggatgttaattttgatagaactcgttggcatataaaataatatatgattatcgtcaaaatttgtagacataattcaaattgacattggccacaaact |
26102772 |
T |
 |
| Q |
116 |
ctgtatatagggtatggttcccaatatacagaacaaaccgcatgcatgatgccttttctctcattctgaagagtagtgtataagacttttgaatttagat |
215 |
Q |
| |
|
||||||||||| |||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
26102773 |
ctgtatataggttatggtctgcaatatacagaacaaaccgcatgcatgttgccttttctctcattctgaagagtagtgtataggacttttgaatttagat |
26102872 |
T |
 |
| Q |
216 |
taagaaaaccacaggctaatggttgttcatc |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
26102873 |
taagaaaaccacaggctaatggttgttcatc |
26102903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University