View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0733_high_69 (Length: 228)
Name: NF0733_high_69
Description: NF0733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0733_high_69 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 7 - 228
Target Start/End: Original strand, 34420945 - 34421166
Alignment:
| Q |
7 |
tcttgaaccccataaaaatagagtcttcaatctagcagagctcatccatacaaggaagatgggataagaaaagagctcttgcagtatattagaataactt |
106 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34420945 |
tcttgaaccccataaaaatagaggcttcaatctagcagagctcatccatacaaggaagatgggataagaaaagagctcttgcagtatattagaataactt |
34421044 |
T |
|
| Q |
107 |
gcacaactaaatttttgaagtacctctctaccatccatttgacaaaatattccactccaagaattgatctgcttacacataacaatccttaagataagaa |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34421045 |
gcacaactaaatttttgaagtacctctctaccatccatttgacaaaattttccactccaagaattgatctgcttacacataacaatccttaagataagaa |
34421144 |
T |
|
| Q |
207 |
agaaagtcttatagatcacatt |
228 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
34421145 |
agaaagtcttatagatcacatt |
34421166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5079 times since January 2019
Visitors: 4845