View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0733_high_71 (Length: 223)
Name: NF0733_high_71
Description: NF0733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0733_high_71 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 1 - 163
Target Start/End: Complemental strand, 13133662 - 13133500
Alignment:
Q |
1 |
ggaacattatctcagcaagtatggcaacgagaaacaatactaaaataggcaggactatatgcacaagaattaccttctatataaataaatatatgagaaa |
100 |
Q |
|
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
13133662 |
ggaacattatctcagcaagtatagcaacgagaaacaatactaaaataggcaggactatatgtacaagaattaccttctatataaataaatatatgagaaa |
13133563 |
T |
 |
Q |
101 |
ctaaagataattttgagattccaaggaacaagatcattattagagaatgcaccatgagcttag |
163 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
13133562 |
ctaaagataattttgagattccaaggaacaagatcattattagagaatgcaccatgagcttag |
13133500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4763 times since January 2019
Visitors: 4839