View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0733_low_115 (Length: 251)
Name: NF0733_low_115
Description: NF0733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0733_low_115 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 13 - 251
Target Start/End: Complemental strand, 28677271 - 28677033
Alignment:
| Q |
13 |
aatatctctgttatctactaccagtattcttgaatagtttctgagaattttgatatttatgactcttgtgttatcttctaccagtattctaccagatagc |
112 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
28677271 |
aatatctctgtaatctactaccagtattcttcaatagtttctgagaattttgatatttatgactcttgtgttatcttctaccagta-tctactagatagc |
28677173 |
T |
 |
| Q |
113 |
attcttaaaattatttgtgctactcccctattgttgttaaaatgaaatattcaga-nnnnnnnaaattattgtttcagcttgatcaaagaggaatcttgc |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28677172 |
attcttaaaattatttgtgctactcccctattgttgttaaaatgaaatattcagattttttttaaattattgtttcagcttgatcaaagaggaatcttgc |
28677073 |
T |
 |
| Q |
212 |
aaggagcaagaagttcacatgctattgccgtagtaggaca |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28677072 |
aaggagcaagaagttcacatgctattgccgtagtaggaca |
28677033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University