View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0733_low_119 (Length: 249)
Name: NF0733_low_119
Description: NF0733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0733_low_119 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 36 - 75
Target Start/End: Complemental strand, 30019349 - 30019310
Alignment:
Q |
36 |
catctgaagctggtccagcttcaacattattattattatc |
75 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
T |
30019349 |
catctgaagctggtccagcttcaacattattattattatc |
30019310 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University