View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0733_low_119 (Length: 249)

Name: NF0733_low_119
Description: NF0733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0733_low_119
NF0733_low_119
[»] chr8 (1 HSPs)
chr8 (36-75)||(30019310-30019349)


Alignment Details
Target: chr8 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 36 - 75
Target Start/End: Complemental strand, 30019349 - 30019310
Alignment:
36 catctgaagctggtccagcttcaacattattattattatc 75  Q
    ||||||||||||||||||||||||||||||||||||||||    
30019349 catctgaagctggtccagcttcaacattattattattatc 30019310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University