View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0733_low_120 (Length: 248)
Name: NF0733_low_120
Description: NF0733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0733_low_120 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 81; Significance: 3e-38; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 14 - 94
Target Start/End: Original strand, 39930385 - 39930465
Alignment:
| Q |
14 |
agaaagtgaagaagtaccagttgaaaaatgttccttgatgttctggtttgtcaaattgatttgcacctaatgatgctgctg |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39930385 |
agaaagtgaagaagtaccagttgaaaaatgttccttgatgttctggtttgtcaaattgatttgcacctaatgatgctgctg |
39930465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 14 - 94
Target Start/End: Complemental strand, 39702914 - 39702834
Alignment:
| Q |
14 |
agaaagtgaagaagtaccagttgaaaaatgttccttgatgttctggtttgtcaaattgatttgcacctaatgatgctgctg |
94 |
Q |
| |
|
|||||||||| ||| |||||||||||||||||||||||| ||| |||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
39702914 |
agaaagtgaaaaagaaccagttgaaaaatgttccttgatcttcaagtttgtcaaactgatttgcacctagtgatgctgctg |
39702834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 14 - 94
Target Start/End: Complemental strand, 39692941 - 39692861
Alignment:
| Q |
14 |
agaaagtgaagaagtaccagttgaaaaatgttccttgatgttctggtttgtcaaattgatttgcacctaatgatgctgctg |
94 |
Q |
| |
|
|||||| ||| ||| |||||||||||||| |||| |||||||||||||||| ||||||||| || |||| ||||||||||| |
|
|
| T |
39692941 |
agaaagcgaaaaagaaccagttgaaaaatattccctgatgttctggtttgttaaattgattggctcctagtgatgctgctg |
39692861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University