View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0733_low_129 (Length: 239)
Name: NF0733_low_129
Description: NF0733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0733_low_129 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 1 - 133
Target Start/End: Complemental strand, 34088061 - 34087925
Alignment:
| Q |
1 |
agttttcttaatatttatctatgttaactttgcggtttttgttgctttttctgtagatgtatggagtag----aaccaattgaaagtgcatttcggtata |
96 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
34088061 |
agttttcttaatatttatctatgttaaatttgcggtttttgttgctttttctgtagatgtatggagtagaagaaaccaattgaaagtgcatttcggtata |
34087962 |
T |
 |
| Q |
97 |
tttattgtttgtcttctgcgtagcgttctgttgctat |
133 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |
|
|
| T |
34087961 |
tttattgtttgtcttaagcgtagcgttctgttgctat |
34087925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University