View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0733_low_131 (Length: 238)
Name: NF0733_low_131
Description: NF0733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0733_low_131 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 71 - 224
Target Start/End: Complemental strand, 7832281 - 7832128
Alignment:
Q |
71 |
atgcttccccaaaacctccctttgttcggtttgataatgttgggacaagagagtgtgaagtttgggttcccttttcagagtaagggatttgtattacttt |
170 |
Q |
|
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
T |
7832281 |
atgcttccccaaaacctccctttgttcggattgataatgttgggacaagagagtgtgaagtttgggttcccttttcagactaagggatttgtattacttt |
7832182 |
T |
 |
Q |
171 |
tgaaggaataaaaggttcctatgtttgaaatagtttcaaaaagattggtctctg |
224 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7832181 |
tgaaggaataaaaggttcctatgtttgaaatagtttcaaaaagattggtctctg |
7832128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University