View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0733_low_134 (Length: 234)

Name: NF0733_low_134
Description: NF0733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0733_low_134
NF0733_low_134
[»] chr3 (1 HSPs)
chr3 (1-115)||(55074063-55074179)


Alignment Details
Target: chr3 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 1 - 115
Target Start/End: Original strand, 55074063 - 55074179
Alignment:
1 ctcccctgttcaattgtaccatccaattgatactat--ggcaatgcatcgatactaagttataattttcgactttacattcaatcaccattctctttatt 98  Q
    ||||||||||||||||||||||||||||||||||||  | ||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||    
55074063 ctcccctgttcaattgtaccatccaattgatactatatgtcaatgcatcgatactaagttataattttcgactttgcatttaatcaccattctctttatt 55074162  T
99 tcatttactatcatatt 115  Q
    || ||||||||||||||    
55074163 tcttttactatcatatt 55074179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University