View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0733_low_137 (Length: 229)
Name: NF0733_low_137
Description: NF0733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0733_low_137 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 1 - 126
Target Start/End: Complemental strand, 28022900 - 28022775
Alignment:
| Q |
1 |
ccttatcggtctccttcaccctcacatagccattgctgccatggccaagaaacttcactaaaacatgtagtttcaggtctgatggcagtggatcaacaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
28022900 |
ccttatcggtctccttcaccctcacatagccattgctgccatggccaagaaacttcactaaaacatgtagtttcaggtctgatggcagcggatcaacaat |
28022801 |
T |
 |
| Q |
101 |
gagagtaactgtttctgtttcatctc |
126 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
28022800 |
gagagtaactgtttctgtttcatctc |
28022775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University